Everything below concerns lyophilisation. We keep the language plain, cite what the science says, and separate well-supported claims from open questions.
Updated 2026-07-13. Numbers and descriptions here follow the published literature rather than marketing material.
Large randomised trials in adults with type 2 diabetes and in adults with obesity have reported reductions in body weight and improvements in several cardiovascular risk markers. One outcome trial found a lower incidence of major adverse cardiovascular events in participants with diabetes and established cardiovascular disease. Gastrointestinal effects such as nausea and vomiting are the most frequently reported adverse events and often diminish over time. Changes in lean body mass during weight loss are an area of ongoing investigation. Effects in adolescents and in pregnancy are less well characterised, and current labelling advises against use during pregnancy.
Semaglutide is a synthetic peptide analogue of glucagon-like peptide-1, a gut hormone released after nutrient intake. The molecule contains 31 amino acid residues and differs from the native sequence at several positions. A non-natural residue at position eight resists the enzyme that normally truncates the hormone, while a lysine-linked fatty diacid side chain promotes binding to serum albumin. These two modifications extend the circulating half-life from minutes to roughly one week. The peptide is produced by solid-phase synthesis followed by selective acylation, and its identity and purity are confirmed by spectrometric and chromatographic techniques.
The primary target is the GLP-1 receptor, a class B G protein-coupled receptor expressed on pancreatic beta cells, in the gut, and in several brain regions. Receptor activation raises intracellular cyclic AMP, which potentiates glucose-dependent insulin secretion and lowers glucagon release when blood glucose is elevated. Signalling in the hypothalamus and brainstem is associated with reduced appetite and slower gastric emptying. Because the insulinotropic effect depends on prevailing glucose levels, the hypoglycaemic risk of the peptide alone is described as low in most study settings. The relative contribution of peripheral and central actions remains an active research question.
Native GLP-1 is degraded rapidly by dipeptidyl peptidase-4. Semaglutide resists this cleavage because alanine at position 8 is replaced by alpha-aminoisobutyric acid. A second substitution at position 34 introduces arginine, which further stabilizes the peptide. The most distinctive modification is a spacer and C18 fatty diacid attached at lysine 26, enabling strong albumin affinity. These three changes together produce a half-life measured in days rather than minutes, and the same structural logic underlies other long-acting analogs in this class.
Semaglutide is a synthetic peptide analog of glucagon-like peptide-1, a hormone released from intestinal L-cells after food intake. It contains 31 amino acids and differs from native GLP-1 through modifications that slow enzymatic breakdown. The peptide was developed to extend the short circulating half-life of endogenous GLP-1, which is measured in minutes. Researchers introduced the compound in the early 2010s. Two backbone changes and a fatty acid side chain define its structure, distinguishing it from earlier GLP-1 receptor agonists.
The compound binds the GLP-1 receptor on pancreatic beta cells and other tissues, activating a G-protein signaling cascade that raises intracellular cyclic AMP. This action increases glucose-dependent insulin secretion when blood glucose is elevated, while binding also slows gastric emptying and reduces glucagon release. In the central nervous system, receptor activation in the hypothalamus and brainstem contributes to reduced appetite. The fatty acid chain binds albumin, which protects the peptide from renal filtration and enzymatic degradation. This albumin binding is central to its extended circulation time.
| Property | Value | Notes |
|---|---|---|
| Molecular class | Acylated GLP-1 receptor agonist | 31-residue synthetic peptide |
| Molecular formula | C187H291N45O59 | established for the free peptide |
| Appearance | White to off-white powder | as supplied before formulation |
| Solubility | Freely soluble in water | aqueous buffers near neutral pH |
| Typical storage | 2 to 8 degrees Celsius, protected from light | powder and solution forms differ in shelf life |
Receptor activation raises intracellular cyclic AMP through Gs coupling, which promotes glucose-dependent insulin release and suppresses glucagon secretion when blood glucose is elevated. Effects outside the pancreas include slower gastric emptying and altered appetite signalling in the hypothalamus and hindbrain. The relative contribution of each tissue to overall metabolic outcomes remains an area of active investigation. Central mechanisms in particular are inferred mainly from animal models and indirect human measures rather than direct observation.
Serum protein binding dominates the pharmacokinetic profile. The attached chain associates strongly with albumin, shielding the peptide from enzymatic attack and slowing filtration by the kidney. This interaction extends the circulation half-life to roughly one week in humans, which supports weekly administration intervals. An oral version pairs the peptide with an absorption enhancer that transiently alters gastric epithelium, permitting limited uptake; bioavailability by that route is substantially lower than by injection.
Semaglutide belongs to the glucagon-like peptide-1 receptor agonist class, a group of synthetic peptides that imitate an incretin hormone released by intestinal L cells after food intake. Native GLP-1 circulates for only a few minutes because dipeptidyl peptidase-4 cleaves it rapidly. The hormone acts on pancreatic islets, the gastrointestinal tract, and several brain regions. Because the natural peptide is short-lived, development work concentrated on analogues that keep receptor activity while resisting enzymatic breakdown and renal clearance.
Stability studies focus on deamidation of asparagine and glutamine residues, oxidation of methionine, and aggregation into higher-order species. The fatty acid side chain adds susceptibility to oxidative change and can promote self-association at high concentration. Lyophilised material is comparatively robust when kept cold and dry, while aqueous solutions require refrigeration and protection from light. Forced degradation experiments under heat, acid, base, and peroxide conditions establish the specificity of each analytical method. Which degradation route dominates under real storage conditions depends on the formulation and stays formulation-specific.
Handling guidance for research quantities calls for single-use aliquots, an inert atmosphere where practical, and avoidance of repeated freeze-thaw cycles that accelerate aggregation. Certificates of analysis typically report purity by peak area, water content, counter-ion identity, and residual solvent levels. In the scientific literature the compound is usually described by its full amino acid sequence, its registry number, or its structural class rather than by any proprietary label. Reporting standards vary between journals, and reviewers increasingly request raw chromatograms alongside tabulated purity figures. Whether current purity thresholds are adequate for every experimental context is debated.
Reversed-phase high-performance liquid chromatography with ultraviolet detection is the dominant approach for peptide purity assessment, usually paired with mass spectrometry to confirm molecular mass and sequence. Peptide mapping by enzymatic digestion and tandem mass spectrometry locates modifications such as deamidation and oxidation. Quantitation in plasma matrices can be performed by LC-MS/MS after solid-phase extraction. Method validation follows general guidance on accuracy, precision, linearity, and limits of detection. Comparability of results between laboratories, when no shared reference standard is available, remains an open question.
Lyophilized semaglutide powder is typically held at minus twenty degrees Celsius for long-term storage. At that temperature, solid-state degradation reactions proceed slowly and the peptide remains intact for extended periods. Repeated freeze-thaw cycles are best avoided because they promote aggregation and can shift the proportion of monomeric peptide present. Working aliquots are often prepared so that each portion is thawed only once, and desiccant is placed inside the vial to limit moisture uptake.
Identity and purity are usually assessed by reverse-phase high-performance liquid chromatography coupled to mass spectrometry. Retention time and observed mass are compared against a reference standard run under identical conditions. Impurity profiles reveal deamidation products, oxidized methionine variants, and truncated fragments that arise during synthesis or storage. Peptide mapping through enzymatic digestion confirms the primary sequence, while amino acid analysis offers an independent check on overall composition.
Solid peptide material is generally kept at reduced temperature to limit degradation. Short-term storage at 2 to 8 degrees Celsius is common, while longer archival storage at minus 20 degrees Celsius or below is typical for lyophilised powder. Vials should remain sealed and protected from light, because ultraviolet exposure can oxidise susceptible residues. Repeated freeze-thaw cycles are avoided, as they promote aggregation and loss of soluble material. Solutions are less stable than solids and are usually prepared close to the time of use.
Reversed-phase high-performance liquid chromatography is widely used to assess purity and to separate the parent peptide from related substances. Mass spectrometry confirms identity and can resolve modifications that differ by a few daltons. Size-exclusion chromatography detects dimers and higher aggregates, which are relevant to both stability and immunogenicity questions. Peptide mapping with enzymatic digestion locates specific modifications along the sequence. Circular dichroism provides a secondary-structure profile, although it gives limited information about local conformational changes.
Quality control for peptide material focuses on identity, purity, content and the profile of impurities. Common degradants include deamidated and oxidised forms, plus aggregates formed during storage or handling. Forced degradation studies under heat, light, acid and peroxide help define which conditions accelerate change and which analytical methods detect it. Limits for individual impurities are set by pharmacopoeial monographs or manufacturer specifications. How much a given impurity affects biological activity is often uncertain, and conclusions may depend on the assay used.
Several international trade union organizations, including the International Trade Union Confederation, Trade Union Confederation of the Americas, and the World Federation of Trade Unions, condemned the attack. Environmental NGOs, including Greenpeace and Oil Change International, have criticised the United States' oil-motivated actions in Venezuela and reiterated calls for a just transition away from fossil fuels. The Federal Council of Switzerland decided to freeze any assets held in the country by Nicolás Maduro.
Furthermore, the reaction conditions can be carefully controlled for desired product distribution, allowing for selective synthesis of desired cage structures. This dynamic character also enables template-directed synthesis, where specific molecular templates can guide the assembly process toward predetermined architectures. Both experimentally and computationally, various synthetic approaches have been developed to control cage formation and optimize yields. The choice of synthetic strategy significantly influences the final cage structure, purity, and scalability of the synthesis. Strategic synthetic approaches range from simple one-pot reactions to sophisticated template-directed methods, each offering distinct advantages.
CTCCAACATCAAGGAAGATGGCATTTCTAG (sequence source: US FDA ETEPLIRSEN BRIEFING DOCUMENT NDA 206488), 30-mer, 20% G, 43% CG, Predicted Tm: 88.9 °C at 10 μM oligo. Oligo complement CTAGAAATGCCATCTTCCTTGATGTTGGAG DMD-001 Exon 51, ENST00000357033.8 in Ensembl.org, RNA target site marked. Given that the target site is within an exon, this is likely blocking binding of an exonic splice enhancer protein and so altering splicing by interfering with splice regulation. CTCCTACTCAGACTGTTACTCTGGTGACACAACCTGTGGTTACTAAGGAAACTGCCATCT CCAAA[CTAGAAATGCCATCTTCCTTGATGTTGGAG]GTACCTGCTCTGGCAGATTTCAACC GGGCTTGGACAGAACTTACCGACTGGCTTTCTCTGCTTGATCAAGTTATAAAATCACAGA GGGTGATGGTGGGTGACCTTGAGGATATCAACGAGATGATCATCAAGCAGAAG
22 December – Circuit Court judge Gerard O'Brien was convicted of the sexual assault of six young men when he was a secondary school teacher during the 1990s. O'Brien is also a former Fianna Fáil party councillor and former State solicitor. He was born with no arms and just one leg as a result of the drug thalidomide. 24 December A man in his 20s died and a second man was seriously injured in a gangland gun attack at a restaurant in Blanchardstown, Dublin. Two men appeared in court in Limerick in connection with a seizure of 300 kg of cocaine worth an estimated €21 million. 28 December – Met Éireann recorded the warmest year on record, with the overall average temperature for Ireland rising above 11 °C (51.8 °F) for the first time.
== F == Facial nerve (Cranial Nerve VII) A cranial nerve that controls the muscles of facial expression, conveys taste sensations from the anterior two-thirds of the tongue, and carries parasympathetic fibers to salivary and lacrimal glands. Facilitation A short-term increase in synaptic strength resulting from prior activity, due to residual calcium in the presynaptic terminal. It contributes to short-term plasticity and temporal coding. Fear conditioning A form of associative learning in which a neutral stimulus becomes associated with an aversive event. It is often used to study emotional memory and the role of the amygdala. Fiber tract A bundle of axons in the central nervous system that connects different brain regions. Examples include the corpus callosum, optic tract, and corticospinal tract. Field potential An electrical potential recorded from a population of neurons, often reflecting the summed synaptic input to a region. Measured using electroencephalography or implanted electrodes. Fight-or-flight response A physiological reaction to perceived threat or danger, involving the sympathetic nervous system and hormones such as epinephrine and cortisol. Forebrain The largest part of the brain, consisting of the cerebrum, thalamus, and hypothalamus. It is involved in complex behaviors, emotion, and cognition. Fornix A C-shaped bundle of white matter fibers that connects the hippocampus to the hypothalamus and other structures in the limbic system. Important for memory and emotional regulation.
Sources: en.wikipedia.org
==== Behavioral consequences ==== The hyperactivity and difficulties in emotional regulation found in pediatric patients (children) are not reported in adults. OSA in adults is nevertheless associated with personality changes and automatic behavior. The biggest impact of OSA is the excessive daytime sleepiness (EDS), reported in approximately 30% of OSA patients. EDS can be caused by the disturbance of sleep quality, the insufficient sleep duration or the sleep fragmentation and it is responsible for further complications as it may lead to depressive symptoms, impairments of social life and decreased effectiveness at work. Studies have shown that those consequences of EDS can be improved following a CPAP treatment.
=== Blood supply === The rectus abdominis has many sources of arterial blood supply. Classification of the vascular anatomy of muscles: First, the inferior epigastric artery and vein (or veins) run superiorly on the posterior surface of the rectus abdominis, enter the rectus fascia at the arcuate line, and serve the lower part of the muscle. Second, the superior epigastric artery, a terminal branch of the internal thoracic artery, supplies blood to the upper portion. Finally, numerous small segmental contributions come from the lower six intercostal arteries as well.
However, in cases of severe kidney dysfunction the CrCl rate will overestimate the GFR, because hypersecretion of creatinine by the proximal renal tubules will account for a larger fraction of the total creatinine cleared. Ketoacids, cimetidine, and trimethoprim reduce creatinine tubular secretion and therefore increase the accuracy of the GFR estimate, in particular in severe kidney dysfunction. (In the absence of secretion, creatinine behaves like inulin.) An alternative estimation of kidney function can be made when interpreting the blood plasma concentration of creatinine along with that of urea. BUN-to-creatinine ratio (the ratio of blood urea nitrogen to creatinine) can indicate other problems besides those intrinsic to the kidney; for example, a urea concentration raised out of proportion to the creatinine may indicate a prerenal problem, such as volume depletion. Counterintuitively, supporting the observation of higher creatinine production in women than in men, and putting into question the algorithms for GFR that do not distinguish for sex, women have higher muscle protein synthesis and higher muscle protein turnover across their life span. As HDL supports muscle anabolism, higher muscle protein turnover links increased creatine to the generally higher serum HDL in women compared with serum HDL in men.
== Tissue distribution == PPARG is mainly present in adipose tissue, colon and macrophages. Two isoforms of PPARG are detected in the human and in the mouse: PPAR-γ1 (found in nearly all tissues except muscle) and PPAR-γ2 (mostly found in adipose tissue and the intestine).
== Pregnancy == Scleroderma in pregnancy is a complex situation; it increases the risk to both mother and child. Overall, scleroderma is associated with reduced fetal weight for gestational age. The treatment for scleroderma often includes known teratogens such as cyclophosphamide, methotrexate, mycophenolate, etc., so careful avoidance of such drugs during pregnancy is advised. In these cases hydroxychloroquine and low-dose corticosteroids might be used for disease control.
Sources: en.wikipedia.org
Equilibrium can be broadly classified as heterogeneous and homogeneous equilibrium. Homogeneous equilibrium consists of reactants and products belonging in the same phase whereas heterogeneous equilibrium comes into play for reactants and products in different phases.
3 July to 21 September Operation Arlington Canyon was a 2nd Battalion 4th Marines and 3rd Battalion 4th Marines clear and search and security operation around Vandegrift Combat Base. The operation resulted in 23 PAVN and ten Marines killed.
== External links == Omnibus Budget Reconciliation Act of 1989 (P.L. 101-239) Omnibus Budget Reconciliation Act of 1993 (P.L. 103-66) Social Security Act Amendments of 1994 (P.L. 103-432) Why it takes 60 minutes or less to find a stark law violation
Transcription occurs in the nucleus using DNA as a template to produce mRNA. In eukaryotes, this mRNA molecule is known as pre-mRNA as it undergoes post-transcriptional modifications in the nucleus to produce a mature mRNA molecule. However, in prokaryotes post-transcriptional modifications are not required so the mature mRNA molecule is immediately produced by transcription.
Sources: en.wikipedia.org
Native GLP-1 is degraded within minutes by dipeptidyl peptidase-4 and neutral endopeptidases. Semaglutide carries a non-natural amino acid at position eight that blocks that cleavage, and a fatty diacid side chain that binds albumin. The result is a much longer duration of action than the native hormone.
The fatty diacid chain associates strongly with serum albumin, which keeps the peptide in circulation and shields it from rapid renal clearance. Bound peptide is released gradually, producing a sustained receptor signal. This mechanism also reduces the peak-to-trough variation seen with shorter-acting analogues.
The balance between peripheral receptor activation and signalling in the central nervous system is not fully resolved. The extent to which slowed gastric emptying accounts for reduced energy intake, compared with direct effects on appetite circuits, is debated. Long-term effects on lean mass and on tissues outside the gut and brain are still under study.
It is a synthetic analog of GLP-1 produced through medicinal chemistry to resist enzymatic degradation. The design goal was longer circulation than the native hormone.